No Release Version
The document you requested has not been released yet.
What is EDIS?
EDIS is the Electronic Data Information Source of UF/IFAS Extension, a collection of information on topics relevant to you.MEANS AND METHODS FOR DETECTING PLASMODIA AND FOR SCREENING OR DIAGNOSING DRUG RESISTANCE OR ALTERED DRUG RESPONSIVENESS OF PLASMODIA
WIPO Patent Application WO/
The present invention relates to the use of fluorescein or derivative(s) thereof for detecting Plasmodia as well as for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia. The present invention furthermore relates to methods and kits for detecting plasmodia as well as for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia utilizing the fluorescein or derivative(s) thereof, preferably provided in a ready to use format, such as in a capillary tube or on a (glass) slide. The present invention allows for fast and simple diagnostics, preferably on the site.
Inventors:
LANZER, Michael (Am Langenmorgen 6, Laudenbach, 69514, DE)
ROHRBACH, Petra (Institute of Parasitology, McGiII University Macdonald Campus,21, 111 Lakeshore Road,Ste-Anne-de-Believ, H9X 3V9 Quebec, CA)
Application Number:
Publication Date:
06/30/2011
Filing Date:
12/22/2010
Export Citation:
UNIVERSIT?T HEIDELBERG (Im Neuenheimer Feld 672, Heidelberg, 69120, DE)
LANZER, Michael (Am Langenmorgen 6, Laudenbach, 69514, DE)
ROHRBACH, Petra (Institute of Parasitology, McGiII University Macdonald Campus,21, 111 Lakeshore Road,Ste-Anne-de-Believ, H9X 3V9 Quebec, CA)
International Classes:
G01N33/569
View Patent Images:
&&&&&&PDF help
Domestic Patent References:
Foreign References:
Other References:
ROHRBACH PETRA ET AL:
"Genetic linkage of pfmdr1 with food vacuolar solute import in Plasmodium falciparum.", THE EMBO JOURNAL 12 JUL 2006 LNKD- PUBMED:, vol. 25, no. 13, 12 July -07-12) , pages , XP, ISSN:
ROHRBACH PETRA ET AL:
"Quantitative calcium measurements in subcellular compartments of Plasmodium falciparum-infected erythrocytes.", THE JOURNAL OF BIOLOGICAL CHEMISTRY 29 JUL 2005 LNKD- PUBMED:, vol. 280, no. 30, 29 July -07-29), pages , XP, ISSN:
SZAK?CS G ET AL:
"Diagnostics of multidrug resistance in cancer.", PATHOLOGY ONCOLOGY RESEARCH : POR 1998 LNKD- PUBMED:9887354, vol. 4, no. 4, 1998, pages 251-257, XP, ISSN:
TOBIE J E ET AL:
"Fluorescent antibody staining of human malaria parasites", EXPERIMENTAL PARASITOLOGY, NEW YORK, NY, US, vol. 11, no. 2-3, 1 September -09-01), pages 128-130,IN1,13, XP, ISSN: , DOI: DOI:10.94(61)90017-0 [retrieved on ]
BORGES-WALMSLEY MI; MCKEEGAN KS; WALMSLEY AR: 'Structure and function of efflux pumps that confer resistance to drugs' BIOCHEM J vol. 376, 2003, pages 313 - 338
COWMAN AF; KARCZ S; GALATIS D; CULVENOR JG: 'A P-glycoprotein homologue of Plasmodium falciparum is localized on the digestive vacuole' J CELL BIOL vol. 113, 1991, pages 1033 - 1042
COWMAN AF; GALATIS D; THOMPSON JK: 'Selection for mefloquine resistance in Plasmodium falciparum is linked to amplification of the pfmdr1 gene and cross- resistance to halofantrine and quinine' PROC NATL A CAD SCI USA vol. 91, 1994, pages 1143 - 1147
DURAISINGH MT; COWMAN AF: 'Contribution of the pfmdr1 gene to antimalarial drug- resistance' ACTA TROP vol. 94, 2005, pages 181 - 190
ECKSTEIN-LUDWIG U; WEBB RJ; VAN GOETHEM ID; EAST JM; LEE AG; KIMURA M; O'NEILL PM; BRAY PG; WARD SA; KRISHNA S: 'Artemisinins target the SERCA of Plasmodium falciparum' NATURE vol. 424, 2003, pages 957 - 961
FOOTE SJ; THOMPSON JK; COWMAN AF; KEMP DJ: 'Amplification of the multidrug resistance gene in some chloroquine-resistant isolates of P. falciparum' CELL vol. 57, 1989, pages 921 - 930
GEE KR; BROWN KA; CHEN WN; BISHOP-STEWART J; GRAY D; JOHNSON I: 'Chemical and physiological characterization of fluo-4 Ca(2+)-indicator dyes' CELL CALCIUM vol. 27, 2000, pages 97 - 106
MUNGTHIN M; BRAY PG; RIDLEY RG; WARD SA: 'Central role of hemoglobin degradation in mechanisms of action of 4-aminoquinolines, quinoline methanols, and phenanthrene methanols' ANTIMICROB AGENTS CHEMOTHER vol. 42, 1998, pages 2973 - 2977
PRICE RN; UHLEMANN AC; BROCKMAN A; MCGREADY R; ASHLEY E; PHAIPUN L; PATEL R; LAING K; LOOAREESUWAN S; WHITE NJ: 'Mefloquine resistance in Plasmodium falciparum and increased pfmdr gene copy number' LANCET vol. 364, 2004, pages 438 - 447
REED MB; SALIBA KJ; CARUANA SR; KIRK K; COWMAN AF: 'Pghl modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum' NATURE vol. 403, 2000, pages 906 - 909
ROHRBACH P; FRIEDRICH 0; HENTSCHEL J; PLATTNER H; FINK RH; LANZER M: 'Quantitative calcium measurements in subcellular compartments of P. falciparum-infected erythrocytes' J BIOL CHEM vol. 280, 2005, pages 27960 - 27969
ROHRBACH P; SANCHEZ CP; HAYTON K; FRIEDRICH O; PATEL J; SIDHU AB; FERDIG MT; FIDOCK DA; LANZER M: 'Genetic linkage of pfindrl with food vacuolar solute import in Plasmodium falciparum' EMBO J vol. 25, no. 13, 2006, pages 3000 - 11
RUBIO JP; COWMAN AF: 'The ATP-binding cassette (ABC) gene family of Plasmodium falciparum' PARASITOL TODAY vol. 12, 1996, pages 135 - 140
SANCHEZ CP; STEIN W; LANZER M: 'Trans stimulation provides evidence for a drug efflux carrier as the mechanism of chloroquine resistance in Plasmodium falciparum' BIOCHEMISTRY vol. 42, 2003, pages 9383 - 9394
SEN S; CHURCHILL GA: 'A statistical framework for quantitative trait mapping' GENETICS vol. 159, 2001, pages 371 - 387
SHAPIRO AB; LING V: 'Positively cooperative sites for drug transport by P-glycoprotein with distinct drug specificities' EUR J BIOCHEM vol. 250, 1997, pages 130 - 137
SIDHU AB; VERDIER-PINARD D; FIDOCK DA: 'Chloroquine resistance in Plasmodium falciparum malaria parasites conferred by pfcrt mutations' SCIENCE vol. 298, 2002, pages 210 - 213
SIDHU AB; VALDERRAMOS SG; FIDOCK DA: 'pfmdr1 mutations contribute to quinine resistance and enhance mefloquine and artemisinin sensitivity in Plasmodium falciparum' MOL MICROBIOL vol. 57, 2005, pages 913 - 926
SU X; FERDIG MT; HUANG Y; HUYNH CQ; LIU A; YOU J; WOOTTON JC; WELLEMS TE: 'A genetic map and recombination parameters of the human malaria parasite Plasmodium falciparum' SCIENCE vol. 286, 1999, pages 1351 - 1353
SZAKACS G; JAKAB K; ANTAL F; SARKADI B: 'Diagnostics ofmultidrug resistance in cancer' PATHOL ONCOL RES vol. 4, 1998, pages 251 - 257
WELLEMS TE; PANTON LJ; GLUZMAN IY; DO ROSARIO VE; GWADZ RW; WALKER-JONAH A; KROGSTAD DJ: 'Chloroquine resistance not linked to mdr-like genes in a Plasmodiumfalciparum cross' NATURE vol. 345, 1990, pages 253 - 255
YAYON A; CABANTCHIK ZI; GINSBURG H: 'Susceptibility of human malaria parasites to chloroquine is pH dependent' PROC NATL ACAD SCI USA vol. 82, 1985, pages 2784 - 2788
Attorney, Agent or Firm:
GRAHN, Sibylla, M. et al. (Boehmert & Boehmert, Anwaltssoziet?tPettenkoferstrasse 20-22, München, 80336, DE)
1. Use of fluorescein or a (acetoxymethylester) derivative thereof for detecting Plasmodia.
2. Use of fluorescein or a (acetoxymethylester) derivative thereof for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia.
3. The use according to claim 1 or 2, wherein the derivative of fluorescein is Fluo-4, or a fluorescein acetoxymethylester, such as fluorescein 4-acetoxymethylester (Fluo-4-AM).
4. The use according to any of claims 1 to 3 comprising determining and evaluating the staining pattern of plasmodia with the fluorescein or (acetoxymethylester) derivative thereof, in particular determining and evaluating the digestive vacuole staining.
5. The use according to any of claims 2 to 4, wherein the drug is a chemotherapeutic drug, in particular an antimalarial drug.
6. The use according to claim 5, wherein the antimalarial drug is selected from quinine, mefloquine, artemisinin derivatives, halofantrine, quinidine and lumefantrine.
7. The use according to any of claims 2 to 6, wherein staining of the plasmodia digestive vacuoles indicates mutated PfMDRl protein(s) associated with altered drug responsiveness, in particular against quinine, mefloquine, artemisinin derivatives, halofantrine, quinidine and/or lumefantrine.
8. The use according to any of claims 2 to 7, wherein staining of the cytoplasm of the plasmodia indicates plasmodia that do not carry mutations in the PfMDRl protein(s) associated with altered drug responsiveness, in particular against quinine, mefloquine, artemisinin derivatives, halofantrine, quinidine and/or lumefantrine.
9. The use according to any of the preceding claims, wherein the Plasmodium is P. falciparum.
10. The use according to any of the preceding claims wherein the fluorescein or a derivative thereof is provided in a ready to use format, preferably in a capillary tube or on a (glass) slide.
11. The use according to any of the preceding claims for diagnostics.
12. A method for detecting plasmodia, comprising
(a) providing a plasmodium-containing sample or a sample of a malaria patient,
(b) providing a dye, preferably a fluorescein or a derivative thereof,
(c) contacting the dye and the sample,
(d) determining and optionally, quantifying, the staining of the sample.
13. A method for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia, comprising
(a) providing a plasmodium-containing sample or a sample of a malaria patient,
(b) providing a dye, preferably a fluorescein or a derivative thereof,
(c) contacting the dye and the sample,
(d) determining and evaluating the staining pattern of the plasmodia with the dye, in particular determining and evaluating the digestive vacuole staining.
14. The method according to claim 12 or 13, wherein the dye is a fluorescein or a derivative thereof, wherein the derivative of fluorescein is Fluo-4 or a fluorescein acetoxymethylester, such as fluorescein 4-acetoxymethylester (Fluo-4- AM).
15. The method according to claim 13 or 14, wherein the drug is a chemotherapeutic drug, in particular an antimalarial drug.
16. The method according to claim 15, wherein the antimalarial drug is selected from quinine, mefloquine, artemisinin derivatives, halofantrine, quinidine and lumefantrine.
17. The method according to any of claims 13 to 16, wherein staining of the plasmodia digestive vacuoles indicates mutated PfMDRl protein(s) associated with altered drug responsiveness, in particular against quinine, mefloquine, artemisinin derivatives, halofantrine, quinidine and/or lumefantrine.
18. The method according to any of claims 13 to 17, wherein staining of the cytoplasm of the plasmodia indicates plasmodia that do not carry mutations in the PfMDRl protein(s) associated with altered drug responsiveness, in particular against quinine, mefloquine, artemisinin derivatives, halofantrine, quinidine and/or lumefantrine.
19. The method according to any of claims 12 to 18, wherein the Plasmodium is P. falciparum.
20. The method according to any of claims 12 to 19, wherein the dye is provided in a ready to use format, preferably in a capillary tube or on a (glass) slide.
21. The method according to claim 20, wherein the dye is provided in dry format and wherein preferably steps (c) and (d) are carried out in the capillary tube or on the (glass) slide.
22. A kit for detecting plasmodia or for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia comprising
fluorescein or a (acetoxymethylester) derivative thereof as defined in any of claims 1 to 3 in an appropriate packaging, preferably in a ready to use format, more preferably in a capillary tube or on a (glass) slide.
23. The kit according to claim 22, wherein the dye is provided in dry format.
Description:
Means and methods for detecting Plasmodia and for screening or diagnosing drug resistance or altered drug responsiveness of Plasmodia
The present invention relates to the use of fluorescein or derivative(s) thereof for detecting Plasmodia as well as for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia. The present invention furthermore relates to methods and kits for detecting plasmodia as well as for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia utilizing the fluorescein or derivative(s) thereof, preferably provided in a ready to use format, such as in a capillary tube or on a (glass) slide. The present invention allows for fast and simple diagnostics, preferably on the site.
BACKGROUND OF THE INVENTION
Malaria is a vector-borne infectious disease caused by protozoan parasites of the genus Plasmodium. It is widespread in tropical and subtropical regions, including parts of the Americas, Asia, and Africa. Each year, there are approximately 350-500 million cases of malaria, killing between one and three million people, the majority of whom are young children in Sub-Saharan Africa. Ninety percent of malaria-related deaths occur in Sub- Saharan Africa. Malaria is commonly associated with poverty, but is also a cause of poverty and a major hindrance to economic development.
Malaria is one of the most common infectious diseases and an enormous public health problem. Five species of the plasmodium parasi the most serious forms of the disease are caused by Plasmodium falciparum. The parasites multiply within red blood cells, causing symptoms that include symptoms of anaemia (light-headedness, shortness of breath, tachycardia, etc.), as well as other general symptoms such as fever, chills, nausea, flulike illness, and, in severe cases, coma, and death. Malaria transmission can be reduced by preventing mosquito bites with mosquito nets and insect repellents, or by mosquito control measures such as spraying insecticides inside houses and draining standing water where mosquitoes lay their eggs. Work has been done on malaria vaccines with limited success and more exotic controls, such as genetic manipulation of mosquitoes to make them resistant to the parasite have also been considered. Although some are under development, no vaccine is currently available for malaria that provides a high preventive drugs must be taken continuously to reduce the risk of infection. These prophylactic drug treatments are often too expensive for most people living in endemic areas. Most adults from endemic areas have a degree of long-term infection, which tends to recur, and also possess partial immunity (resistance); the resistance reduces with time, and such adults may become susceptible to severe malaria if they have spent a significant amount of time in non-endemic areas. They are strongly recommended to take full precautions if they return to an endemic area. Malaria infections are treated through the use of antimalarial drugs, such as quinine or artemisinin derivatives. The latter are administered in combination with another antimalarial drug form of an artemisinin combination therapy. However, parasites have evolved to be resistant to many of these drugs. Therefore, in some areas of the world, only a few drugs remain as effective treatments for malaria. Thus, options to control the spread of malaria are increasingly limited as widely used antimalarials are losing their efficacy, including the 4-aminoquinoline drug chloroquine and the folate antagonists pyrimethamine and sulfadoxine. Moreover, reduced susceptibility has emerged to other antimalarials, including quinine, mefloquine, and artemisinin derivatives and artemisinin combination therapies.
Rohrbach et al. describe the genetic linkage of pfmdrl with food vacuolar solute import in Plasmodium falciparum (Rohrbach et al. 2006).
Thus, the present invention aims to provide means and methods for drug resistance testing and screening, in particular for altered drug responsiveness of plasmodia.
It is a further objective of the present invention to provide means and methods for detecting malaria or its respective pathogenic agents.
SUMMARY OF THE INVENTION
According to the present invention this object is solved by using fluorescein or a derivative thereof for detecting plasmodia.
According to the present invention this object is furthermore solved by using fluorescein or a derivative thereof for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia.
According to the present invention this object is furthermore solved by providing a method for s detecting plasmodia.
Said method comprises
(a) providing a plasmodium-containing sample or a sample of a malaria patient,
(b) providing a dye, preferably a fluorescein or a derivative thereof,
(c) contacting the dye and the sample,
(d) determining and optionally, quantifying, the staining of the sample.
According to the present invention this object is furthermore solved by providing a method for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia.
Said method comprises
(a) providing a plasmodium-containing sample or a sample of a malaria patient,
(b) providing a dye, preferably a fluorescein or a derivative thereof,
(c) contacting the dye and the sample,
(d) determining and evaluating the staining pattern of the plasmodia with the dye, in particular determining and evaluating the digestive vacuole staining.
According to the present invention this object is furthermore solved by providing a kit for detecting plasmodia or for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia.
Said kit comprises fluorescein or a (acetoxymethylester) derivative thereof in an appropriate packaging, preferably in a ready to use format, more preferably in a capillary tube or on a (glass) slide.
DESCRIPTION OF THE PREFERRED EMBODIMENTS OF THE INVENTION
Before the present invention is described in more detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art. For the purpose of the present invention, all references cited herein are incorporated by reference in their entireties.
Detecting plasmodia and diagnosing drug resistance or altered drug responsiveness of Plasmodia utilizing fluorescein or derivatives thereof
As outlined above, the present invention provides the use of fluorescein or a derivative thereof for detecting plasmodia.
Preferably, the detection of plasmodia allows the diagnosis of malaria.
As outlined above, the present invention also provides the use of fluorescein or a derivative thereof for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia.
The fluorescein and fluorescein derivative(s) of the present invention preferably accumulate in the plasmodia digestive vacuoles and, thus,
- allow detection of plasmodia (and, thus, diagnosis of malaria),
- provide a staining pattern, preferably a staining of the plasmodia digestive vacuoles, as explained herein in further detail.
Fluorescein:
Preferably, the derivative of fluorescein is molecular formula: C36H25F2K5N20i3 ; molecular weight: 927.09
- a fluorescein acetoxymethylester,
fluorescein 4-acetoxymethylester (Fluo-4- AM)
molecular formula: C5iH50F2N2O23; molecular weight: 1096.95;
CAS Number/Name: -3 /Glycine, N-[4-[6-[(acetyloxy)methoxy]- 2,7- difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2- [bis[2-[(acetyloxy)methoxy]-2- oxoethyl] amino] -5- methylphenoxy] ethoxy]phenyl] -N- [2- [(acetyloxy)methoxy] - 2-oxoethyl]-, (acetyloxy)methyl ester.
Fluo-4 was developed as a fluorescent dye for quantifying cellular Ca2+ concentrations in the 100 nM to 1 mM range. Fluo-4 is an analog of Fluo-3 (with two chlorine substituents replaced by fluorines) and is available from Invitrogen. Fluo-4 has a fluorescence excitation maximum at 488 nm. Fluo-4 exhibits a large fluorescence intensity increase on binding Ca , with an emission maximum at 516 nm. The Fluo-4 fluorescence signal is pH dependent and increases with decreasing pH.
Fluorescein acetoxymethylester (AM) derivates are hydrophobic, cell-permeant substances that only fluoresce after AM hydrolysis by intracellular esterases (Szakacs et al, 1998).
Preferably, the drug is a chemotherapeutic drug, in particular an antimalarial drug.
Preferably, the antimalarial drug is selected from quinine, mefloquine, artemisinin, halofantrine, quinidine and lumefantrine.
Preferably, the antimalarial drug is not chloroquinine.
The uses according to the invention comprise determining and evaluating the staining pattern of plasmodia with the fluorescein or (acetoxymethylester) derivative thereof, in particular determining and evaluating the digestive vacuole staining.
The respective staining pattern of the parasite indicates whether the parasite (or respective sample) tested shows drug resistance or altered drug responsiveness: (i) The staining of the plasmodia digestive vacuoles preferably indicates mutated PfMDRl protein(s) associated with altered drug responsiveness, in particular against quinine, mefloquine, artemisinin, halofantrine, quinidine and/or lumefantrine.
(ii) The staining of the cytoplasm of the plasmodia preferably indicates plasmodia that do not carry mutations in the PfMDRl protein(s) associated with altered drug responsiveness, in particular against quinine, mefloquine, artemisinin, halofantrine, quinidine and/or lumefantrine.
Furthermore, the staining of the plasmodia furthermore allows the detection of the plasmodia themselves. Preferably, the detection of plasmodia allows the diagnosis of malaria.
In both microorganisms and tumors, drug resistance can arise from the presence of P- glycoproteins (P-gp) that are capable of extruding a broad range of structurally and functionally unrelated cytotoxic agents (Borges-Walmsley et al, 2003). P-gp belong to the ABC (ATP-binding cassette) transporter superfamily and are encoded by mdr genes. The human malaria parasite Plasmodium falciparum possesses an mdr homologue (pfmdrl) whose gene product, Pgh-1, is expressed during intraerythrocytic development of the parasite (Foote et al, 1989). Pgh-1 has a domain structure typical of P-gp, with two homologous domains, each comprising a hydrophobic membrane-associated segment with six transmembrane domains followed by a hydrophilic nucleotide binding fold. Pgh-1 is mainly localized to the membrane of the parasite's acidic food vacuole (Cowman et al, 1991), with its ATP binding domain facing the cytoplasm (Cowman et al, 1991). pfindrl polymorphisms have been implicated in several drug resistance phenotypes. For example, a clinical study has shown a strong association between pfmdrl amplification and mefloquine treatment failure and in vitro resistance (Price et al, 2004). pfmdrl amplification is further associated with in vitro resistance to halofantrine and quinine (Cowman et al, 1994). Furthermore, polymorphisms at amino acid residues 86, 184,
and 1246 have been associated with altered in vitro susceptibility to chloroquine, quinine, mefloquine and artemisinin (Reed et al, 2000; Sidhu et al, 2005). In particular, the N1042D substitution seems to play a prominent role in low-level quinine resistance (Sidhu et al, 2005), while the N86Y substitution has been implicated in contributing to lumefantrine and high level chloroquine resistance (Duraisingh and Cowman, 2005). The inventors show a surrogate assay for Pgh-1 function based on the subcellular distribution of Fluo-4 acetoxymethylester and its free fluorochrome. The inventors identified two distinct Fluo-4 staining phenotypes: preferential staining of the food vacuole versus a more diffuse staining of the entire parasite. Genetic, positional cloning and pharmacological data causatively link the food vacuolar Fluo-4 phenotype to those Pgh-1 variants that are associated with altered drug responses. Moreover, Pgh-1 imports solutes, including certain antimalarial drugs, into the parasite's food vacuole (Rohrbach et al, 2006; Sanchez et al., 2008). Thus, the respective staining pattern of the parasite indicates altered drug responsiveness.
Fluorescein AM derivates are hydrophobic, cell-permeant substances that only fluoresce after AM hydrolysis by intracellular esterases (Szakacs et al, 1998). Cells expressing P-gp expel the non-fluorescent probe, resulting in decreased accumulation of the fluorescent dye in the cytoplasmic compartment (Szakacs et al, 1998). Because the free fluorochrome is a poor substrate, P-gp transport activity can be quantitatively assessed by measuring the net accumulation of intracellular fluorescence, thereby providing information regarding P-gp protein levels and the directionality of transport (Szakacs et al, 1998). The inventors have found genetic, positional cloning and pharmacological evidence suggesting that Pgh-1 mediates solute import into, as opposed to solute efflux from, the food vacuole.
Moreover, the inventor's data show that the Fluo-4 staining pattern provides a live cell surrogate assay for Pgh-1 variants associated with altered drug responses and, thus, can be used for testing and screening of patient samples.
Preferably, the plasmodium is Plasmodium falciparum.
Plasmodium falciparum is a protozoan parasite that causes the most virulent form of malaria in humans (tropical malaria). Other Plasmodial species that can cause malaria in humans are: Plasmodium ovale (tertian malaria), Plasmodium malariae (quartan malaria), Plasmodium vivax (tertian malaria) and Plasmodium knowlesi. P. falciparum is transmitted by the female Anopheles mosquito during a blood meal. P. falciparum is the most dangerous of these infections as P. falciparum (or malignant) malaria has the highest rates of complications and mortality. It accounted for 91% of all 515 million malaria-attributed disease episodes (98% in Africa) and 90% of the 1-2 million deaths. P. falciparum is highly prevalent in sub-Saharan Africa, but the parasite is also found in other tropical and subtropical regions, including Southeast Asia, Central and South America and the oceanic region.
In a preferred embodiment, the fluorescein or the derivative(s) thereof is provided in a ready to use format.
Preferred ready to use formats are in a capillary tube or on a (glass) slide (such as a microscopy glass slide).
In the preferred embodiment, the capillary tube comprises/contains inside the appropriate dye, preferably in a dry format. Thus, the sample (such as blood from the fingertip of a patient) can be directly taken with the capillary tube and the sample (blood) interacts with the dye in the capillary.
The user/technician then simply turns the capillary tube up and down by hand (no centrifuging required). The capillary tube is then put on a holder that allows the user/technician to look at it through a fluorescent microscope for any fluorescing malaria parasites.
Capillary tubes can be produced commercially to guarantee a reliable controlled quality. Every capillary contains an equal amount of dye and has a defined inner volume. This guarantees the right molarity of the appropriate dye in the blood specimen (signal to back ground relation).
A commercially available example for capillary tubes provided with a fluorescent dye is the CBC(TM) Malaria Test (QBC Diagnostics, Inc.) which can be applied with the QBC(TM) ParaLens System (QBC Diagnostics, Inc.). The preferred embodiment of the present invention can be carried out using respective capillary tubes provided with the fluorescent dyes according to the present invention, preferably in combination with the QBC(TM) ParaLens System or similar systems.
The dye also can be applied on a (microscopy) (glass) slide and used in a "ready to use" format, preferable in a dry format on an application field on the (glass) surface. Thus, a respective (blood) sample can be directly applied or dropped to the respective application field on the (glass) surface of the microscopy (glass) slide.
The uses according to the invention as described herein are preferably utilized for diagnostics.
Whereas diagnostics allow a fast and simple testing and screening with respect to
detecting plasmodia and, thus, diagnosing malaria
screening or diagnosing drug resistance or altered drug responsiveness of plasmodia.
In particular, the ready to use formats (as described herein) allow diagnostics on the site, which can be carried out fast and simple.
Thus, the present invention can be carried out in the laboratory or the field.
Method(s) for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia
As outlined above, the present invention provides a method for detecting plasmodia.
The first method according to the invention comprises the following steps
(a) providing a plasmodium-containing sample or a sample of a malaria patient,
(b) providing a dye, preferably a fluorescein or a derivative thereof,
(c) contacting the dye and the sample,
(d) determining and optionally, quantifying, the staining of the sample. Preferably, the detection of plasmodia allows the diagnosis of malaria.
As outlined above, the present invention provides a method for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia.
The second method according to the invention comprises the following steps
(a) providing a plasmodium-containing sample or a sample of a malaria patient,
(b) providing a dye, preferably a fluorescein or a derivative thereof, (c) contacting the dye and the sample,
(d) determining and evaluating the staining pattern of the plasmodia with the dye, in particular determining and evaluating the digestive vacuole staining.
In one embodiment,
step (a) comprises
(al) providing a blood sample
(a2) washing the sample twice in Ringer's solution and resuspending in Ringer's solution at a haematocrit of 5%
and step (c) comprises
(cl) adding the dye to the sample (200 μ?) at a concentration of 5 μΜ in Ringer's solution containing Pluronic F-127 (0.1% v/v);
(c2) incubating for 25 min at 37 °C;
(c3) washing the sample in Ringer's solution.
Preferably, step (d) comprises
determining and evaluating the staining pattern of the plasmodia with the dye, in particular determining and evaluating the digestive vacuole staining, by exciting the sample at an appropriate wavelength (such as at a wavelength of 488 nm) and recording the fluorescence signal using an appropriate filter (such as a LP 505 nm filter) and a detection device, such as a fluorescence microscope.
Preferably, the evaluation in step (d) comprises quantifying the staining pattern.
Preferably, the dye is a fluorescein or a derivative thereof, wherein the derivative of fluorescein is Fluo-4 or a fluorescein acetoxymethylester, such as fluorescein 4- acetoxymethylester (Fluo-4-AM), as described herein.
Preferably, the drug is a chemotherapeutic drug, in particular an antimalarial drug.
Preferably, the antimalarial drug is selected from quinine, mefloquine, artemisinin derivatives, halofantrine, quinidine and lumefantrine.
Preferably, the antimalarial drug is not chloroquinine. As described above, the respective staining pattern of the parasite indicates whether the parasite (or respective sample) tested shows drug resistance or altered drug responsiveness:
(i) The staining of the plasmodia digestive vacuoles preferably indicates mutated PfMDRl protein(s) associated with altered drug responsiveness, in particular against quinine, mefloquine, artemisinin derivatives, halofantrine, quinidine and/or lumefantrine.
(ii) The staining of the cytoplasm of the plasmodia preferably indicates plasmodia that do not carry mutations in the PfMDRl protein(s) associated with altered drug responsiveness, in particular against quinine, mefloquine, artemisinin derivatives, halofantrine, quinidine and/or lumefantrine.
Furthermore, the staining of the plasmodia furthermore allows the detection of the plasmodia themselves. Preferably, the detection of plasmodia allows the diagnosis of malaria.
Preferably, the plasmodium is P. falciparum.
In a preferred embodiment, the dye is provided in a ready to use format.
Preferred ready to use formats are in a capillary tube or on a (glass) slide (such as a microscopy glass slide).
More preferably, the dye is provided in dry format.
More preferably, steps (c) and (d) are carried out in the capillary tube or on the (glass) slide.
In the preferred embodiment, the capillary tube comprises/contains inside the appropriate dye, preferably in a dry format. Thus, the sample (such as blood from the fingertip of a patient) can be directly taken with the capillary tube and the sample (blood) interacts with the dye in the capillary.
The user/technician then simply turns the capillary tube up and down by hand (no centrifuging required). The capillary tube is then put on a holder that allows the user/technician to look at it through a fluorescent microscope for any fluorescing malaria parasites.
Capillary tubes can be produced commercially to guarantee a reliable controlled quality. Every capillary contains an equal amount of dye and has a defined inner volume. This guarantees the right molarity of the appropriate dye in the blood specimen (signal to back ground relation).
A commercially available example for capillary tubes provided with a fluorescent dye is the CBC(TM) Malaria Test (QBC Diagnostics, Inc.) which can be applied with the QBC(TM) ParaLens System (QBC Diagnostics, Inc.). The preferred embodiment of the present invention can be carried out using respective capillary tubes provided with the fluorescent dyes according to the present invention, preferably in combination with the QBC(TM) ParaLens System or similar systems.
The dye can also be applied on a (microscopy) (glass) slide and used in a "ready to use" format, preferable in a dry format on an application field on the (glass) surface. Thus, the sample (such as a respective blood sample) can be directly applied or dropped to the respective application field on the (glass) surface of the microscopy (glass) slide
The methods according to the invention allow for fast and simple diagnostics, in particular testing and screening with respect to
detecting plasmodia and, thus, diagnosing malaria
screening or diagnosing drug resistance or altered drug responsiveness of plasmodia.
In particular, the ready to use formats (as described herein) allow diagnostics on the site, which can be carried out fast and simple. Thus, the present invention can be carried out in the laboratory or the field.
Kit(s) for detecting plasmodia or for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia As outlined above, the present invention provides a kit for detecting plasmodia or for screening or diagnosing drug resistance or altered drug responsiveness of plasmodia.
The kit according to the present invention comprises
fluorescein or a (acetoxymethylester) derivative thereof as defined herein in a packaging, preferably an appropriate packaging.
Preferred appropriate packagings are:
(1) a suitable container e.g. plastic bottle,
(2) a ready to use format, preferably in a capillary tube or on a (glass) slide (such as a microscopy glass slide).
Preferably, the dye is provided in dry format.
In case of (1):
The dye is provided in a suitable container e.g. plastic bottle and then mixed with the sample (such as a blood specimen).
In case of (2) (as described above):
The capillary tube comprises/contains inside the appropriate dye, preferably in a dry format. Thus, the sample (such as blood from the fingertip of a patient) can be directly taken with the capillary tube and the blood interacts with the dye in the capillary.
The dye is applied on a (microscopy) (glass) slide and used in a "ready to use" format, preferable in a dry format on an application field on the glass surface. Thus, the sample (such as a respective blood sample) can be directly applied or dropped to the respective application field on the (glass) surface of the microscopy glass slide
The kit further comprises respective instructions, such as for carrying out the methods of the present invention.
Preferred embodiment
The inventors have identified and characterized two distinct Fluo-4 staining phenotypes in P. falciparum-m' fected erythrocytes. Some parasites, including HB3, showed a diffuse fluorescence of the entire parasite, whereas other parasites, such as Dd2, revealed an intense Fluo-4 staining of the food vacuole and only a weak cytoplasmic fluorescence (see Figure 1).
As Fluo-4 is a non-ratiometric Ca2+ indicator, the inventors considered the possibility that the differences in Fluo-4 staining patterns reflect strain variations in Ca2+ homeostasis. However, no significant differences in food vacuolar or cytoplasmic free Ca2+ concentrations were observed in the four representative parasites investigated. The quantitative Ca2+ determinations relied on Fura-Red AM, a ratiometric Ca indicator that provides reliable recordings of steady state free [Ca2+]j in different subcellular compartments of P. falciparum- infected erythrocytes (Rohrbach et al, 2005). The steady-state food vacuolar and cytoplasmic free [Ca ]j values reported herein are consistent with previous determinations (Rohrbach et al, 2005).
A model to explain the Fluo-4 phenotypes involves altered fluorochrome handling. Fluo-4 belongs to a group of structurally related fluorescein derivatives that, when present as AM, are known substrates of multi-drug efflux systems (Szakacs et al, 1998) (Figure 7A). Our finding that, in Dd2, the Fluo-4 staining pattern responded to several established P-gp inhibitors, yielding a staining pattern similar to that of HB3, provided evidence for mechanistic similarities to dye transport in tumor cells. The very characteristic pharmacological profile - partially sensitive to cyclosporine A and highly sensitive to the third generation P-gp inhibitors ONT-093 and XR-9576 at concentrations as low as 3 nM (for XR- 9576) - suggests that the proposed carrier belongs to the family of multi-drug resistance transporters. The observed segregation of the Fluo-4 staining phenotype with pfmdrl in the genetic cross between HB3 and Dd2 supports this model. The LOD score of & 6 suggests strong linkage with pfmdrl. Indeed all progeny displaying a food vacuolar staining phenotype have the Dd2 pfmdrl allele whereas all progeny with a diffuse staining pattern inherited the HB3 pfmdrl allele.
Investigating several genetically engineered pfmdrl mutants confirmed the causative linkage of the food vacuolar Fluo-4 staining phenotype with certain pfmdrl polymorphisms. The single amino acid replacement D104 N within the HB3 pfmdrl allele altered the Fluo-4 phenotype of a diffuse to a food vacuolar staining pattern. Similarly, replacing the amino acids C1034S, D1042N, Y1246D within the pfmdrl of 7G8 resulted in a food vacuolar Fluo-4 phenotype from the original diffuse Fluo-4 staining pattern displayed by 7G8. Interestingly, all mutants that have a food vacuolar staining pattern maintain the N86, F184, S1034, N1042, D1246 allelic form of pfmdrl (Figure 5A). Thus, two allelic forms of pfmdrl are associated with a food vacuolar Fluo-4 phenotype, namely Y86, Y184, S1034, N1042, D1246 (Dd2, Kl and FCB) and N86, F184, S1034, N1042, D1246 (allelic exchange mutants) (Figure 5A). The related allelic form N86, F184, S1034, D1042, D1246, which differs by a single amino acid substitution at position 1042, replacing the negatively charged aspartic acid by the amide asparagine, showed a diffuse staining pattern. Similarly, a diffuse staining pattern was observed for N86, Y184, S1034, N1042, D1246, which differs by single amino acid substitutions at positions 86 or 184. This finding suggests a specific interaction with Fluo-4 (Figure 7B). The clones CDY0003 and CDY3BA6, encoding the N86, F184, C1034, D1042, Y1246 allelic form of pfmdrl, showed an interesting phenotype in that their Fluo-4 Rvac/cyt values were significantly lower than those of the parental clones GC03 and 3BA6 or that of HB3 (Figure 5 A).
The inventors further noted that the Pgh-1 protein level contributes to the food vacuolar Fluo- 4 phenotype. There is a trend towards this effect in the progeny from the genetic cross, which was genetically validated by investigating FCB and its isogenic clone KDlmdrl. Disruption of one of the two pfmdrl copies decreased Pgh-1 protein level in KDlmdrI and to the same extent reduced the Fluo-4 Rvac/cyt value, albeit the overall staining pattern remained that of a food vacuolar phenotype (Figure 4C and D).
The inventors' data causatively link the Fluo-4 phenotype to pfmdrl, there are clear differences to mdir-mediated fluorochrome efflux in cancer cells. In tumor cells, P-gp expel the non-fluorescent esterified probe, resulting in reduced intracellular fluorescence (Szakacs et al, 1998) (Figure 7A, left scheme), while in some P. falciparum parasites the fluorochrome accumulates in an intracellular compartment. These apparent differences can be reconciled when the different subcellular localizations of P-gp and Pgh-1 are considered. In tumor cells, P-gp are localized to the plasma membrane, whereas Pgh-1 mainly resides within the parasite's food vacuolar membrane (Cowman et al, 1991; Cremer et al, 1995). On the basis of these considerations, it appears that Pgh-1, in a variant-dependent manner, pumps solutes into the food vacuole (Figure 7A, right scheme). Inwardly-directed transport is fully consistent with the predicted topology of Pgh-1, with its ATP-binding domain facing the cytoplasm (Cowman et al, 1991; Karcz et al, 1993). The inventors' model is supported by several independent lines of evidence: i) the food vacuolar phenotype intensified with increasing pfmdrl copy number (Figure 4C and D);
ii) Fluo-4 AM, but more importantly, the membrane-impermeable form, Fluo-4 salt, accumulated in the food vacuoles of permeabilized erythrocytes infected with Dd2 in an ATP-dependent manner (Figure 6B); and
iii) accumulation of Fluo-4 salt (permeabilized cells, Figure 6B) and Fluo-4 AM (live cells, Figure 3) could be inhibited by the established P-gp inhibitor XR-9576. In comparison to mammalian P-gp, which transports Fluo-4-AM and only poorly the de-esterified form (Szakacs et al, 1998), Pgh-1 seems to use both Fluo-4 salt and Fluo-4- AM as substrates.
The conclusion that Pgh-1 can transport solutes into the food vacuole has major implications for the interpretation and detection of antimalarial drug responses. The Pgh-1 variants that most effectively concentrate Fluo-4 salt / Fluo-4 AM in the food vacuole are those that have been linked to reduced susceptibility to artemisinin derivatives, halofantrine and mefloquine and increased susceptibility to quinine (Reed et al, 2000; Sidhu et al, 2005). Conversely, parasites expressing the N86, F184, C1034, D1042, Y1246 allelic form of pfmdrl concentrate the least Fluo-4 salt / Fluo-4 AM in their food vacuoles and concomitantly have an increased susceptibility to mefloquine, halofantrine and possibly artemisinin derivatives (Reed et al, 2000; Sidhu et al, 2005). Thus, the Fluo-4 staining pattern directly correlates with certain drug responses, providing a rapid cell-based diagnostic assay for pfmdrl polymorphisms associated with various drugs. Indeed, accumulation of Fluo-4 into the food vacuole can be competed by mefloquine, halofantrine, quinine and artemisinin derivatives, but not chloroquine (Figure 6C). For quinine, a concentration dependent response was established (Figure 6D), albeit Fluo-4 Rvac/cyt values could not be reduced to the level observed in parasites with a diffuse fluorescence staining pattern, possibly because Pgh-1, like human P-gp (Shapiro and Ling, 1997), may possess multiple transport-active and substrate-specific binding sites (in this case one for Fluo-4 salt / Fluo-4 AM and one for quinine) that may interact in a cooperative fashion. Chloroquine, a highly acidotropic compound that accumulates in the parasite's food vacuole, and possibly alkalinizing this compartment (Yayon et al, 1985), had no effect on the food vacuolar Fluo-4 fluorescence, providing further evidence for the inventors' model that the Fluo-4 staining pattern is unrelated to pH. The inventors' finding that chloroquine does not compete with Fluo-4 in HB3 and Dd2 is consistent with genetic and positional cloning experiments that dissociated chloroquine resistance from the Pgh-1 polymorphisms displayed by HB3 and Dd2 (Sidhu et al, 2005), although other Pgh-1 variant may directly or indirectly interact with chloroquine (Reed et al, 2000).
On the basis of these findings it appears that various forms of Pgh-1 transport several antimalarial drugs into the food vacuole. For mefloquine, halofantrine and artemisinin derivatives, it may be advantageous to the parasite to sequester these drugs in a compartment where they are less harmful. Recent evidence of possible cytoplasmic targets for artemisimn derivatives is fully consistent with this concept (Eckstein-Ludwig et al, 2003). Alternatively, Pgh-1 itself may be the target of antimalarial drugs, as suggested for mefloquine (Rubio and Cowman, 1996). In the case of quinine, its site of action is believed to be the food vacuole (Mungthin et al, 1998) and concentrating the drug in this organelle ma consequently pfindrl polymorphisms are selected that mediate reduced drug import. Importantly, the N1042D substitution that has been associated with low-level quinine resistance (Sidhu et al, 2005) abrogates accumulation of Fluo-4 in the food vacuole (Figure 5A). In summary, the inventors' study provides evidence for Pgh-1 mediated solute import into the parasite's food vacuole in a manner that may involve interactions at several, if not all, polymorphic residues.
The following examples and drawings illustrate the present invention without, however, limiting the same thereto.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 Fluo-4 fluorescence in different P. falciparum parasites.
(A) Single images of P. falciparum-infected erythrocytes stained with Fluo-4 AM (green) and the acidotropic dye LS Blue (blue). Bar, 5 μπι.
(B) Mean Fluo-4 fluorescence quantified from the food vacuolar and cytoplasmic regions. (C) Ratios of the mean Fluo-4 fluorescence signals in the vacuolar and cytoplasmic regions (Rvac/cyt)- The means ± S.E. of over 15 independent determinations collected over several days are shown in panels B and C. ** P & 0.001 and P & 0.05, comparing the vacuole and cytoplasm of the two groups of parasites, respectively.
Figure 2 Linkage of the Fluo-4 phenotype to pfmdrl. (A) Fluo-4 Rvac/cyt in the progeny from the HB3 x Dd2 cross. The dotted line indicates the cutoff level of fluorescence ratio, as defined by HB3. H and D indicate the pfindrl haplotypes of HB3 and Dd2, respectively. The mean ± S.E. of over 60 independent determinations are shown.
(B) QTL analysis of Fluo-4 Rvac/cyt using Pseudomaker.
(C) Secondary scan using Pseudomaker to search for minor QTL. Dashed lines represent the threshold values calculated from 1000 permutations (Churchill and Doerge, 1994). The P. falciparum chromosomes are indicated.
Figure 3 Confocal Fluo-4 AM imaging of vacuolar and cytosolic fluorescence in P. falciparum in the presence of various inhibitors.
(A) Images of Dd2 parasites were obtained after loading with Fluo-4 AM in the presence of the P-gp inhibitors cyclosporin A (CSA), ONT-093 (ONT), XR-9576 (XR) or verapamil (VP). Bar, 5 μπι.
(B) Ratio of the vacuolar and cytosolic fluorescence (Fluo-4 Rvac/cyt) measured in Dd2 and HB3 in the presence of various P-gp inhibitors. The concentrations used are indicated. The mean ± S.E. of over 10 independent determinations are shown. ** P & 0.001.
Figure 4 pfindrl overexpression contributes to the food vacuolar Fluo-4 phenotype. (A) The pfindrl copy number of the progeny, analyzed as a function of Fluo-4 Rvac/cyt- The solid circles represent copy numbers that are in agreement using both real-time PCR and Southern analysis. For Dd2, 3BB1 and B1SD, diverging results were obtained (solid triangles and solid squares, S corresponding open symbols, real-time PCR). TC08 (grey circle) represents a clone that harbors one pfindrl gene copy number measured in both methods, yet shows a high Fluo-4 Rvac/cyt ratio.
(B) Pgh-1 protein levels analyzed as a function of Fluo-4 Rvac/cyt values. Symbols are as in (A).
(C) Pgh-1 protein levels evaluated in FCB (harboring two pfindrl gene copies) and its isogenic clone KDlmdrl (harboring one pfindrl copy).
(D) Fluo-4 Rvac/cyt ratios quantified in FCB and KDlmdrl. Means ± S.E. of over 40 independent determinations collected over several days are shown. ** P & 0.001.
Figure 5 Association of the Fluo-4 phenotype with pfindrl polymorphisms. (A) Fluo-4 staining images and ratios of the mean fluorescence signals in the vacuolar and cytoplasmic regions (Fluo-4 Rvac/cyt)5 observed in different pfmdrl allelic exchange mutants generated on either a GC03, 3BA6, 7G8 or a D10 genetic background (Reed et al, 2000; Sidhu et al, 2005) (Table II). NS, not significant as compared to GC03, 3BA6, 7G8 or D10. Means ± S.E. of over 12 independent determinations collected over several days are shown. (B) Fluo-4 staining images and Fluo-4 Rvac/cyt ratios observed in different pfcrt allelic exchange mutants (Sidhu et al, 2002). C4 and C6 contain the Southeast Asian/ African and Latin American pfcrt alleles from Dd2 and 7G8, respectively (Sidhu et al, 2002). GC03 is the parental clone and C2GC03 is a control retaining the pfcrt allele of GC03. NS, not significant (compared to GC03). The means ± S.E. of over 14 independent determinations collected over several days are shown. ** P & 0.001; NS, not significant. Bar, 5 μηι.
Figure 6 Substrate specificity of Pgh-1.
(A) Food vacuolar fluorescence of intact erythrocytes infected with Dd2 after incubation with the membrane impermeable fluorochrome Fluo-4 salt and the membrane permeable variant Fluo-4 AM. Means ± S.E. of over 15 independent determinations are shown. a.u., arbitrary units. ** P & 0.001.
(B) Food vacuolar fluorescence of permeabilized erythrocytes infected with Dd2 using Fluo-4 salt and Fluo-4 AM in the presence and absence of 2 mM ATP. Where indicated XR-9576 (3 μΜ) was added. Means ± S.E. of over 20 independent determinations are shown. ** P & 0.001 without and with ATP; m P & 0.001 without and with XR-9576.
(C) Competition of food vacuolar Fluo-4 fluorescence with different antimalarial drugs. Erythrocytes infected with either Dd2 or HB3 or the pfmdrl allelic exchange mutant SND3BA6 and its parental clone 3BA6 were incubated with Fluo-4 AM (5 μΜ) in the presence of 100 nM of chloroquine (CQ), mefloquine (MQ), halofantrine (HF), quinine (QN) or artemisinin (ART) and Fluo-4 Rvac/cyt ratios were determined. Means ± S.E. of over 20 independent determinations are shown. ** P & 0.001.
(D) Erythrocytes infected with Dd2 or HB3 were incubated with Fluo-4 AM (5 μΜ) and increasing concentrations of quinine and the Fluo-4 Rvac/cyt ratios were determined. Means ± S.E. of over 20 independent determinations are shown.
Figure 7 Models of Fluo-4 AM transport in tumor cells and P. falciparum.
(A) Fluo-4 AM passively diffuses through membranes and can be actively extruded by P-gp in tumor cells (left). In parasites, Fluo-4 AM enters by passive diffusion and is converted to the free fluorochrome Fluo-4. Some Pgh-1 variants are capable of pumping both Fluo-4 AM and the membrane impermeable Fluo-4 into the food vacuole. Fluo-4 AM entering the food vacuole is de-esterified by esterases present in this organelle (right) (Krugliak et al, 2003). (B) Predicted topology of Pgh-1. Polymorphisms associated with both increased Fluo- 4 AM / Fluo-4 import into the food vacuole and altered drug responses are indicated. NBD, nucleotide binding domain.
Materials and methods Chemicals and antibodies
Fluo-4 acetoxymethylester (AM), Fluo-4 pentapotassium salt, Fura-Red AM, LysoSensor Blue DND-192, Pluronic F-127, Alexa Fluor 680 goat anti-rabbit IgG and Alexa Fluor goat anti-mouse IgG were purchased from Invitrogen. The Ca2+-ionophore nigericin was purchased from Calbiochem (Germany). The P-gp inhibitor Cyclosporin A (CSA) was obtained from Sigma (Germany), ONT-093 was kindly supplied by Ontogen and XR-9576 by Xenova. Chloroquine, artemisinin and quinine were purchased from Sigma (Germany), mefloquine from Roche (Germany), and halofantrine from GalaxoSmithKline (UK), a-tubulin clone B-5- 1-2 was purchased from Sigma (Germany) and a-Pgh-1 was a kind gift from A. Cowman.
P. falciparum culture
P. falciparum parasites were maintained in continuous in vitro cultures (adapted from Trager and Jensen, 1976). Live cell experiments were carried out using synchronized P. falciparum trophozoites harvested 28 - 34 hours post invasion.
Dye loading of P. falciparum parasites
Cells were washed twice with Ringer's solution (122.5 mM NaCl, 5.4 mM KC1, 1.2 mM CaCl2, 0.8 mM MgCl2, 11 mM D-glucose, lO mM HEPES, 1 mM NaH2P04, pH 7.4) and loaded with 5 μΜ Fluo-4 AM in Ringer's solution with Pluronic F-127 (0.1% v/v) or Fluo-4 for 40 min at 37°C. Dye loaded parasites were settled onto poly-L-lysine coated coverslips in a micro-perfusion chamber. Unbound parasites and remaining dye were washed away by perfusion with Ringer's solution. For the double labeling experiments, Ringer's solution was supplemented with 1 μΜ of the fluorescent dye LysoSensor Blue DND-192. The P-gp inhibitors verapamil (30 μΜ), CSA (10 μΜ), ONT-093 (10 and 1 μΜ) and XR-9576 (3 μΜ and 3 nM) were added to P. falciparum-infected erythrocytes 10 min prior to loading with Fluo-4 AM. For the competition assays, 100 nM of the antimalarial drugs chloroquine, mefloquine, halofantrine, quinine or artemisinin were incubated with 5 μΜ Fluo-4 AM for 40 min at 37°C.
Selective Permeabilization of the Erythrocyte and Parasite Plasma Membranes
Infected erythrocytes were permeabilized by brief exposure to saponin (0.01 %, w/v), permeabilizing both the host cell membrane and the parasitophorous vacuole membrane and giving extracellular solutes access to the parasite plasma membrane. The plasma membrane of the parasite was permeabilized using digitonin, permitting solutes added to the extracellular medium access to the food vacuolar membrane. Isolated parasites were suspended in 2 ml of ice-cold buffer (HO mM KC1, 30 mM NaCl, 2 mM MgCl2, 5 mM HEPES, pH 7.3). The cell suspension was kept on ice for 5-10 min before adding digitonin (0.02 %, w/v). The cells were mixed gently and returned to ice for additional 4 min, after which time 1 ml of ice-cold buffer containing 1 mg/ml bovine serum albumin (BSA) was added. The permeabilized parasites were immediately centrifuged (15,800 χ g) for 1 min, washed twice (1 min at 15,800 x g) with 1 ml of the same BSA-containing solution, and then once in buffer without BSA. Digitonin- permeabilized parasites were suspended in buffer and placed at 37°C until use (within 30 min to 1 h). Permeabilized parasites were loaded with 5 μΜ of either Fluo-4 AM or Fluo-4; and ATP was supplemented at 2 mM where mentioned. XR-9576 (3 μΜ) was added to permeabilized erythrocytes, maintained at 37°C, 10 min prior to addition of the fluorochrome.
Live cell imaging
Confocal scanning fluorescence microscopy was performed using a Zeiss LSM510 (Carl Zeiss, Germany) equipped with UV and visible laser lines. Multi-Track mode was used for LysoSensor Blue DND-192 (excited at 364 nm with emission detected using the BP 385— 470 nm filter, blue channel) and Fluo-4 AM or Fluo-4 (excited at 488 nm with emission using LP 505 nm filter, green channel). Optimized laser settings were: excitation 488 nm with 1% transmission, and 364 nm with 2% transmission. Single images were obtained using a 63x lens (C-APO, N.A. = 1.2) with an 8-fold software zoom at 512 x 512 pixel. For Fluo-4 AM (or Fluo-4) labeling alone, Single-Track mode was applied using the above mentioned laser and filter. Regions of interest restricted to either the vacuole or the cytosol of the parasite were defined and fluorescence intensity quantified, using the LSM510 v3.2 software. In-situ Co2* -calibration of Fura-Red
The fluorescent calcium indicator Fura-Red AM was used to measure the intracellular free calcium concentration, as described (Rohrbach et al, 2005). Mean resting free [Ca2+]i were compared between the vacuole and the cytoplasmic area using a Student's t-test at the P = 0.05 level.
Genome-wide scans
The Dd2 x HB3 genetic cross and genetic linkage map have been previously described (Su et al, 1999). QTL linked to Fluo-4 fluorescence were analyzed using Pseudomaker (Sen and Churchill, 2001).
Real-Time PCR
pfmdrl copy number was determined by TaqMan real-time PCR using an ABI 7700. The pfmdrl probe was FAM(TM) (6-carboxyfluorescein) labeled at the 5 '-end, and the a-tubulin probe was VIC(TM) labeled. Both probes had a TAMRA(TM) label at the 3 '-end. Amplification reactions were done in MicroAmp 96 well plates in 25 μ?, volumes, containing TaqMan buffer, passive reference dye ROX (5-carboxy-X-rhodamine), 300 nM forward and reverse primer, 100 nM of each probe, and 100 ng purified parasite genomic DNA. 40 cycles were performed (95°C for 15 s and at 58°C for 1 min). Fluorescence data were expressed as normalized reporter signals, calculated by dividing the amount of reporter signal by the passive reference signal. The optimal detection threshold was determined for the assay conditions and used for every run. Results were analyzed by a delta-delta Ct method. The assay was replicated four independent times and normalized to HB3, which was included in every run. Primers and probes used were:
SEQ ID NO. pfmdrl sense TTAAGTTTTACTCTAAAAGAAGGGAAAACATAT 1 pfmdrl mtisense TCTCCTTCGGTTGGATCATAAAG 2 pfmdrl probe CATTTGTGGGAGAATCAGGTTGTGGGAAAT 3 a-tubulinsense TGATGTGCGCAAGTGATCC 4 a-tubulin31 56"56 TCCTTTGTGGACATTCTTCCTC 5 a -tubulin probe TAGCACATGCCGTTAAATATCTTCCATGTCT 6 Pgh-1 expression levels
Magnet-purified trophozoite-infected erythrocytes were isolated as described (Sanchez et al, 2003). After purification, erythrocytes were lysed by hypotonic shock at 4°C. Protein amounts were determined using Bradford assays (BioRad, Germany). Samples were run on NuPAGE Novex Tris-Acetate gels (Invitrogen, Germany) and transferred onto a 0.2μηι PDVF membrane (BioRad, Germany). Membranes were blocked overnight at 4°C using 5% milk in PBS. Primary antibodies (a-Pgh-1 and a-tubulin, both diluted 1 :1,000) were incubated for 1 h at RT in 1% BSA / PBS. Membranes were washed 3 times using PBS / 0.1% Tween for 10 min at RT and then blocked again in 5% milk in PBS for 1 h. Secondary antibodies (Alexa Fluor 680 goat anti-rabbit IgG, or Alexa Fluor goat anti-mouse IgG, both diluted 1 :10,000) were added to 1% BSA / PBS for 30 min at RT. After washing 4 times in PBS / 0.1% Tween for 5 min at RT, signals were read using an Odyssey-Li-cor infrared imaging system (Li-cor Biosciences). Fluorescence intensities for Pgh-1 were normalized using fluorescence intensities measured for a-tubulin. The resulting values were then expressed in relation to HB3.
Statistical analysis
Statistical significance (P value) was tested using the Student's t-test (Sigma Plot, SPSS software).
Further material
The wildtype protein sequence of Pgh-1 /MDR1 is shown in SEQ ID NO. 7, which is the wildtype sequence of P. falciparum strain 3D7 (Accession Number CAD51594).
Table I shows pfindrl inheritance and copy number in various parasites. Table II shows relevant point mutations in Pgh-1.
Clonal variation in Fluo-4 live cell imaging
Figure 1A depicts fluorescent images of different P. falciparum parasites loaded with Fluo- 4 AM under standardized conditions. While the Dd2, Kl and FCB parasites showed a bright Fluo-4 fluorescence in the food vacuole and a weak fluorescence in the cytoplasm, the HB3, NF54 and 7G8 parasites revealed a distinctly more diffuse staining pattern of the entire parasite. The acidic food vacuole of the parasite was localized using the acidotropic dye LysoSensor Blue DND-192 (LS Blue) (Rohrbach et al, 2005). The clonal variations in Fluo-4 staining were confirmed by quantifying the fluorescence intensities in the food vacuole and cytoplasm (Figure IB). Both values differed significantly between the two sets of parasites, with Dd2, Kl and FCB having higher food vacuolar and lower cytoplasmic Fluo-4 fluorescence as compared to HB3, NF54 and 7G8. Accordingly, the ratio of the food vacuolar over cytoplasmic fluorescence (Rvac/c t) differed 2 to 3-fold between these two sets of parasites (Figure 1C).
Because Fluo-4 fluorescence is calcium-dependent, with the fluorescence increasing with rising free calcium concentrations ([Ca2+] , we wondered whether the differences observed in Fluo-4 live cell imaging were due to variations in intracellular Ca2+ homeostasis. Since Fluo-4 is a non-ratiometric Ca2+ indicator, calibrating the fluorescence signals is difficult. In a previous study, we used the ratiometric fluorophore Fura-Red AM to quantify free [Ca2+], in different subcellular compartments of the parasite and observed that Fura-Red, in a confocal setting, provided reliable and robust recordings of both steady-state and dynamic free [Ca ]i (Rohrbach et al, 2005). We applied this method to a representative number of parasites. No significant differences in cytoplasmic or food vacuolar free [Ca2+]i were found between the examined parasites Dd2, Kl, HB3 and NF54 (P & 0.05) (Table III). The free [Ca2+]j values measured were consistent with previous determinations (Biagini et al, 2003; Biagini et al, 2005; Rohrbach et al, 2005).
Table III. Steady-state free food vacuolar and cytoplasmic [Ca2+]j in different P. falciparum parasites.
Parasite Vacuolar [Ca ]i Cytoplasmic [Ca ],
Dd2 454 ± 60 (n=54) 352 ± 42 (n=73)
Kl 375 ± 57 (n=46) 289 ± 39 (n=45)
HB3 450 ± 52 (n=64) 397 ± 34 (n=81) NF54 441 ± 91 (n=23) 302 ± 29 (n=40)
Genetic linkage of the Fluo-4 phenotype to pfmdrl
We next investigated the Fluo-4 fluorescence pattern in 16 genetically distinct progeny from a cross between Dd2 and HB3 (Su et al, 1999; Wellems et al, 1990) (Figure 2 A). Quantitative trait locus (QTL) analysis revealed a locus on chromosome 5, with the highest LOD score of & 6 associated with the pfmdrl marker (Figure 2B). In fact, all progeny that displayed an intense food vacuolar Fluo-4 staining phenotype contained the Dd2 pfindrl allele (Y86, Y184, S1034, N1042 and D1246), whereas progeny with a diffuse Fluo-4 staining inherited the HB3 pfmdrl allele (N86, F184, S1034, D1042 and D1246) (Figure 2A). To assess the possible linkage with other loci, a secondary scan was performed with the effect of pfindrl removed. No other significant QTL was found (Figure 2C).
To investigate whether pfmdrl itself plays a role in the Fluo-4 phenotype, we examined the effect of established P-gp inhibitors on the subcellular Fluo-4 fluorescence pattern. For Dd2, addition of P-gp inhibitors before and during loading with Fluo-4 AM significantly altered the Fluo-4 fluorescence pattern. The preferential staining of the food vacuole over the cytoplasm was substantially reduced in the presence of cyclosporine A (CSA, 10 μΜ), a first generation P-gp inhibitor, and was completely ablated in the presence of the third generation P-gp inhibitors ONT-093 (ONT, 1 μΜ and 10 μΜ) and XR-9576 (XR, 3 nM and 3 μΜ) (Figure 3A and B). In the case of XR-9576, a concentration of as low as 3 nM sufficed to render the Fluo-4 fluorescence image similar to that of HB3. Verapamil (VP, 30 μΜ) did not significantly affect the Fluo-4 staining pattern (Figure 3A and B). For HB3, P-gp inhibitors had no significant effect on the Fluo-4 staining pattern (Figure 3B) and a diffuse staining of the entire parasite remained.
Pgh-1 overexpression enhances food vacuolar Fluo-4 staining
The pfmdrl loci of HB3 and Dd2 differ regarding polymorphisms (see above) and copy number (1 versus 3-4, respectively). Taking this into account, we found that the food vacuolar phenotype, in addition to being linked with the Dd2 pfmdrl allele, was further associated with an increased pfmdrl copy number in the progeny of the HB3 x Dd2 cross (Figure 4A), with the exception of TC08, which contains only one pfmdrl gene. Using quantitative real time PCR, we generally confirmed the published pfmdrl copy numbers (Wellems et al, 1990), although quantitative real time PCR indicated lower values for B1SD, 3BB1 and Dd2 (Figure 4A, Table I).
The correlation between pfmdrl copy number and the Fluo-4 phenotype improved when directly assessing the Pgh-1 protein level. Pgh-1 amounts were quantified by Western analysis, normalized against a-tubulin and expressed in relation to the Pgh-1 level of HB3. All progeny with a diffuse Fluo-4 staining pattern contained the HB3 pfmdrl allele and had Pgh-1 protein levels comparable to that of HB3, whereas all progeny with a bright food vacuolar staining contained the Dd2 pf drl allele and had 1.5 to 3.0 - fold higher Pgh-1 protein levels, including TC08 (Figure 4B, Table I).
To better assess the contribution of Pgh-1 protein levels to the Fluo-4 phenotype, we examined the parasite FCB and its isogenic clone KDlmdrl, in which one of the two pfmdrl gene copies present were destr